Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.018774 |
Chromosome: | chromosome 14 |
Location: | 3499635 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g630700 | (1 of 2) IPR006212//IPR009030//IPR011641 - Furin-like repeat // Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCACCACCACCTCGCGATCCGTCGTGGCGCGCTCGTTGTGCCCGCTC |
Internal bar code: | TCGGTTGTTTTAGCTTCATCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 798 |
LEAP-Seq percent confirming: | 20.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAAGCTTCGGGAACTCCAG |
Suggested primer 2: | GCCCTACAGTACCTACCCCA |