| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.018877 |
| Chromosome: | chromosome 10 |
| Location: | 3258329 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g442700 | RVB2,RUVBL2,Reptin | Nucleoside-triphosphatase, RuvB-like protein; (1 of 1) K11338 - RuvB-like protein 2 [EC:3.6.4.12] (RUVBL2, RVB2, INO80J) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCAGAACGGCTGGGATAGGTGGCAAGATCGTGCACGCGAGAGCTCGG |
| Internal bar code: | AACAGTCACCCTGTTTCTTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1522 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGAGTCCTTGACTGCAGC |
| Suggested primer 2: | GCACCTGTTGAGGAACGAGA |