| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.018901 |
| Chromosome: | chromosome 5 |
| Location: | 2163126 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237200 | DRP4C,DRP6 | Dynamin-related GTPase; (1 of 1) IPR000375//IPR001401//IPR020850//IPR022812//IPR027417 - Dynamin central domain // Dynamin, GTPase domain // GTPase effector domain, GED // Dynamin superfamily // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTGGGCCGCAGGTAGGCGCGCTTCATGCGGGCCAGGAAGTCGGCTTG |
| Internal bar code: | TGTCACGTTTAGATCAGGCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2935 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTGAAGCCTGAGTGCTG |
| Suggested primer 2: | CACTGGGATGGTGGAAGGTC |