| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.018937 |
| Chromosome: | chromosome 5 |
| Location: | 2429407 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238687 | PHC35 | Pherophorin-chlamydomonas homolog 35; (1 of 1) IPR011993//IPR024616 - Pleckstrin-homology domain (PH domain)/Phosphotyrosine-binding domain (PTB) // Pherophorin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTCCTGGATCGAGGAGGTCTCGGGCGCGGGCTGCCCCGTGGAGGTGGC |
| Internal bar code: | TAATATTTTGAATCGATTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 503 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTCACCCTGTCAATGGCA |
| Suggested primer 2: | CATAACGACTGAGCTTGCGC |