| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.019091 |
| Chromosome: | chromosome 7 |
| Location: | 3746237 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338150 | RNP1,ChlMEI2g,MEI2,AML1 | MEI2 RNA binding protein; (1 of 2) K17579 - protein phosphatase 1 regulatory subunit 42 (PPP1R42, LRRC67) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCGGCGTGGACGCGGACCTGGACTCGCTGGGGGCGGACATCGCATCC |
| Internal bar code: | GAGGTTGCCGGCTATAGCCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2081 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTGTTGTGCAAAGCGAT |
| Suggested primer 2: | CGGCGAACAATGCGACTAAG |