Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.019334 |
Chromosome: | chromosome 1 |
Location: | 72423 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g000450 | ERR2,AXL2 | (1 of 6) PTHR10994//PTHR10994:SF61 - RETICULON // RETICULON-LIKE PROTEIN; Arabinose chain extension enzyme like protein 2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCCTTGAACCGCCCCAGCACCTGCCGCAGCTCGCGGTCCACCAGCGG |
Internal bar code: | CCAAGCCCATAGGTTCGATACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2272 |
LEAP-Seq percent confirming: | 88.3721 |
LEAP-Seq n confirming: | 76 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGAGTGACCCAGTTCGTT |
Suggested primer 2: | GATCACCATCGGACGCATCT |