| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.019368 |
| Chromosome: | chromosome 1 |
| Location: | 8107371 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g064727 | ZRT4 | (1 of 18) 2.7.10.2//2.7.11.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGGACGAGCACGCGGTGAACACACATGCATGCGACACGTGGGCGCGT |
| Internal bar code: | CAGCTCAACTCGACAGGTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1737 |
| LEAP-Seq percent confirming: | 93.1034 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTAAGTCCACAAGGAGGC |
| Suggested primer 2: | CAACAGTGCAAGCCTTCCAC |