| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.019372 |
| Chromosome: | chromosome 12 |
| Location: | 8726834 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g547450 | VPS9 | Guanine nucleotide exchange factor, vacuolar; (1 of 1) PF02204 - Vacuolar sorting protein 9 (VPS9) domain (VPS9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGGCGATTGCGGCAGGAGCATGAGCACGATGATGCGATCATTATGGT |
| Internal bar code: | GAGGGGTGGAGGCTAGGATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1089 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGAACTGCGACAGGTCCA |
| Suggested primer 2: | CTCTGGTGACTGCTGTGGTT |