Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.019393 |
Chromosome: | chromosome 1 |
Location: | 2837128 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g017600 | PQQ2 | (1 of 8) IPR011047//IPR018391 - Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat; Putative quinoprotein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGGCACGTCTTTACGGCTGCCACCACGTGCACACTGCGTTCGTGCCG |
Internal bar code: | TATAGCGATGATCATGGTTATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3760 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCCAGTTCCCCTATAGCA |
Suggested primer 2: | CTTGTTGCGTGGTTGGAGTG |