| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.019407 |
| Chromosome: | chromosome 2 |
| Location: | 7705279 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g147050 | (1 of 7) PF05517 - p25-alpha (p25-alpha); P25 Alpha Domain Containing Flagellar Associated Protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCAACGAACATCACGCCATTCCGAAGATTTCCCCGAAATCTTGTGTA |
| Internal bar code: | TCGAGACTATAAATACTGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2687 |
| LEAP-Seq percent confirming: | 80.6452 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCTTCTCCTGCAGGGTGC |
| Suggested primer 2: | TTCATCGCCTTTGCCAGCTA |