| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.019525 |
| Chromosome: | chromosome 12 |
| Location: | 6322383 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g536900 | (1 of 1) IPR000104//IPR003072//IPR003495//IPR011629//IPR012336//IPR027417 - Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type // CobW/HypB/UreG domain // Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal // Thioredoxin-like fold // P-loop containing nucleoside triphosphate hydrolase; Putative metallochaperone | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCATGATCAGGATCAGGATCACAACCATGATCATGATCATGATCATGA |
| Internal bar code: | TGTATATATCAGGAAGGAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 305 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCGTTGTTACCAGGTGAT |
| Suggested primer 2: | TGGACTTGGATGGTTGGACG |