| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.019648 |
| Chromosome: | chromosome 8 |
| Location: | 4082849 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383050 | (1 of 1) 3.7.1.14 - 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCTGCCTGGGAGTCGCCCTCGTGCGCTGTGCACTGGTGCTCACCGCC |
| Internal bar code: | TGATGGATAATCTTAAGAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 219 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCCTCTCCACCCCATTA |
| Suggested primer 2: | CCATGCAACGCACATAGTCG |