| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.019710 |
| Chromosome: | chromosome 1 |
| Location: | 4583392 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031550 | CSB6 | (1 of 12) IPR004843//IPR029052 - Calcineurin-like phosphoesterase domain, apaH type // Metallo-dependent phosphatase-like; Probable transposon-derived protein of Chlamydomonas-Specific family B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTGTTTTGTGTGTTTTTGTGAGTATATGTGTGTTTTGGGGGGGGGGAT |
| Internal bar code: | GAACAGAGGTCCAGCAAGTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTCCTTTGCTTCGCCGAG |
| Suggested primer 2: | CATGTACACCCAGTGCCCTT |