Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.019787 |
Chromosome: | chromosome 16 |
Location: | 7024969 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g673953 | FKB16-7,FKB16G,FKB10 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516//PTHR10516:SF261 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // FKBP-TYPE PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKPA | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTGTGGGGCAAACCACCGTTCTGGAGGTAAGCCCCAGTGCCAGGCAC |
Internal bar code: | ATAGAAGCCACGCCGATAGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1729 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGTGGTGCAATGACGGTG |
Suggested primer 2: | TTATGGGTCTGCAGGTGCTG |