Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.019848 |
Chromosome: | chromosome 6 |
Location: | 8473163 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g308850 | EIF3X | (1 of 1) K03245 - translation initiation factor 3 subunit J (EIF3J); hypothetical eIF3-like protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACGGCCGTTGGAGCGCCAACGCAACACCCGTCCCGCCAAAACCCGGT |
Internal bar code: | ACAGTACTGGCAGGTGTTCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1804 |
LEAP-Seq percent confirming: | 24.3243 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCGCTCGTTGTTTTGTGA |
Suggested primer 2: | CTTGTGTTGGCAGTTGGAGC |