| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.019916 |
| Chromosome: | chromosome 11 |
| Location: | 1340312 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467708 | (1 of 1) IPR029022 - ABC transporter, BtuC-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAACCCAACTAAACCGGCAGGTGGGGGGCTGGGGGCCGGGGAGAGGG |
| Internal bar code: | CCCCTGTATCCGTAATGGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 968 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGGATGTAGTGGTGGTG |
| Suggested primer 2: | AAATTCCCGGGGGCGTTAAT |