Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.019964 |
Chromosome: | chromosome 15 |
Location: | 867557 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g640250 | (1 of 1) K07562 - nonsense-mediated mRNA decay protein 3 (NMD3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAATCCCAGCCGATGCCCGCACCCACCCCCGTTCACAGCGTCTGACGTG |
Internal bar code: | TATCTCTAATCAAATGCAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 250 |
LEAP-Seq percent confirming: | 76.9231 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTCCGGGCATTGAGTAGT |
Suggested primer 2: | AGTTTGTTGTGTCCGCATGC |