| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.019984 |
| Chromosome: | chromosome 7 |
| Location: | 2895785 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g332500 | AXT2 | (1 of 3) PTHR10994:SF69 - PROLINE-RICH PROTEIN 18; Arabinose chain extension enzyme for HRGP 2 | 3'UTR |
| Cre07.g332550 | PSL1 | Signal peptide peptidase, eukaryotic-type; (1 of 1) PTHR12174//PTHR12174:SF23 - SIGNAL PEPTIDE PEPTIDASE // MINOR HISTOCOMPATIBILITY ANTIGEN H13 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCCTCCTCCGCCGCCTCGCTGAAGTCAAACACGCTCTTGAACTCCCG |
| Internal bar code: | AGAAGATGCATAATTTAATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4412 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 70 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGCTAGATGGGTGGGGTA |
| Suggested primer 2: | TGGCCTACCTGCTAAGCCTA |