Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.020050 |
Chromosome: | chromosome 12 |
Location: | 5752478 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g532500 | (1 of 2) K03453 - bile acid:Na+ symporter, BASS family (TC.BASS); Sodium:bile acid symporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTCATCATGTGCGGGAGTAGGCGCCAGCACGTTACACGCTGCTCCGAA |
Internal bar code: | ACTGCTATATTTAAAGGTTGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1628 |
LEAP-Seq percent confirming: | 87.5 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCTACTCGCAAAGCAGTT |
Suggested primer 2: | ACTGCTTGGTGAAGACGGAG |