| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.020071 |
| Chromosome: | chromosome 10 |
| Location: | 5113349 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455231 | CSR4 | Carbohydrate sulfotransferase-related 4; (1 of 1) 2.8.2.23 - [Heparan sulfate]-glucosamine 3-sulfotransferase 1 / Heparin-glucosamine 3-O-sulfotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGGGTGTGGGGATGGCTTGCCGGCGAAGGGAGGGCCCGTGCTTTTGC |
| Internal bar code: | GAAATTTCCCCCATAGTAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 655 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCACCCTGGAAGAAGTGCG |
| Suggested primer 2: | TTCCCAGGAGACAGGAGAGG |