Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.020102 |
Chromosome: | chromosome 2 |
Location: | 5718836 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g116450 | RPE2 | (1 of 2) K01783 - ribulose-phosphate 3-epimerase (rpe, RPE); Ribulose phosphate-3-epimerase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTGATGTGAAGTTGTTAAGCCAGGGGGGAAAGCGTGTGGACGCAGGC |
Internal bar code: | AGGTTCTTTGACTCTTTAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2519 |
LEAP-Seq percent confirming: | 85.9649 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCACCTGGATGTTGAGGTC |
Suggested primer 2: | TAGTGAGTCCGCTTTGCCTG |