Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.020113 |
Chromosome: | chromosome 17 |
Location: | 161922 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g696950 | (1 of 2) IPR000719//IPR001229//IPR001245//IPR002290//IPR011009//IPR016187//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // C-type lectin fold // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCCGGGGCCCAGTTGCGCGGCCGGCGAGGGCTGCACCCGAGAGGCCA |
Internal bar code: | GAGATCGGTCCTGATTAGTAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2041 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCGCTACGCTGAACCAGT |
Suggested primer 2: | AAACCCATCTGCCCATCAGG |