| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.020124 |
| Chromosome: | chromosome 15 |
| Location: | 867196 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g640250 | (1 of 1) K07562 - nonsense-mediated mRNA decay protein 3 (NMD3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCATCCCGCCCTCATTCGCACCCTACTCCTTCGGCGCATGGTATCGCC |
| Internal bar code: | TTCTGTAACCGGTAGCGAATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 290 |
| LEAP-Seq percent confirming: | 61.9048 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGGTGGGATGGTGGTGG |
| Suggested primer 2: | CGTGGCAATGCATGTACTCG |