Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.020144 |
Chromosome: | chromosome 16 |
Location: | 516422 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692751 | PDI3 | Protein disulfide isomerase 3; (1 of 1) K13984 - thioredoxin domain-containing protein 5 (TXNDC5, ERP46) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCGACGGGCCCCCCTTCATCAGCCGAACTGTGTCACGCGCGCTGCTA |
Internal bar code: | GGTCGTGGTGCTTTGAAATGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2214 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCGTCTCTGGAGTGTTT |
Suggested primer 2: | GTTCGCAGCTGCAACTCAAA |