Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.020205 |
Chromosome: | chromosome 3 |
Location: | 3016989 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g163500 | EX1,CGLD21 | Executer 1, chloroplastic; (1 of 1) PTHR33917//PTHR33917:SF1 - FAMILY NOT NAMED // PROTEIN EXECUTER 1, CHLOROPLASTIC | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGGTCGGGGGCAAGACCGGGTTCACCTGGGGCCAGGGACTATTTGGC |
Internal bar code: | CTAGTGCTGTCGTCACATTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1273 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATTTTCCAGTCGCCCACCC |
Suggested primer 2: | AGGTGCGTTGCAATAGCTCT |