Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.020358 |
Chromosome: | chromosome 10 |
Location: | 2522142 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g436100 | MLK1 | Mixed lineage protein kinase; (1 of 2) PF00069//PF01590//PF07714 - Protein kinase domain (Pkinase) // GAF domain (GAF) // Protein tyrosine kinase (Pkinase_Tyr) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTAAATTTCGGACTGCGGCTAAACCGCCCATCACACGACCAGCTGAG |
Internal bar code: | GGTGATTGGTGGGTCAACTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5877 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 176 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 176 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGACTACAGACCCAAACC |
Suggested primer 2: | CAGCTTCAGGATGGAGGCAA |