| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.020405 |
| Chromosome: | chromosome 17 |
| Location: | 5572714 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739650 | MAE1,MFT1 | MATE efflux family protein; (1 of 5) PTHR11206//PTHR11206:SF94 - MULTIDRUG RESISTANCE PROTEIN // DNA-DAMAGE-INDUCIBLE PROTEIN F | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGCCCACGCACCGCGGCCAGCTGCGTGGAACCGGCGTGCCCCATGT |
| Internal bar code: | AGTGACTACATTACAGGCGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2497 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGAGACCTCAAGACTGGC |
| Suggested primer 2: | ACATGGCTGTTGCTACTGCT |