Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.020425 |
Chromosome: | chromosome 12 |
Location: | 1865491 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g512200 | MFT26 | Major facilitator superfamily transporter; (1 of 1) PTHR23504//PTHR23504:SF15 - FAMILY NOT NAMED // PROTEIN ZINC INDUCED FACILITATOR 1-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTGGCCAGCTCGAGCTCGATTGCCCGCTGCTGGGCACTGTCCACCCG |
Internal bar code: | ATTCTTGACTTTCTTAGTGGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1706 |
LEAP-Seq percent confirming: | 36.3636 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCAACAGTGGTATGGACG |
Suggested primer 2: | GCATCTCTTCTAGTCCGGCC |