Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.020457 |
Chromosome: | chromosome 15 |
Location: | 1849112 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g141706 | ERA1 | Putative chloroplast 16S rRNA processing factor; (1 of 1) K03595 - GTP-binding protein Era (era) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCCCGATCTCAGGTACCGAAAGCCGTGAGGGTAGATCATCCGAGCTG |
Internal bar code: | TCATTCGAGGCGAAGTTGTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 729 |
LEAP-Seq percent confirming: | 58.8235 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCAAGGGGTTGGGAACTT |
Suggested primer 2: | GTCCCAAGTCAAACCGTTGC |