| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.020579 |
| Chromosome: | chromosome 5 |
| Location: | 1105696 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248100 | ANK1 | Predicted protein with ankyrin repeats; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAAAACGCTCATTTCAGCTGCGCTCTCCTCAGTGCCTCTCCTCTCAC |
| Internal bar code: | CGGCCGACCAGTAGAGATATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1715 |
| LEAP-Seq percent confirming: | 98.6842 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGTCGTGAAACTCGCC |
| Suggested primer 2: | CTGCTACACGTGCGCATTAC |