| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.020598 |
| Chromosome: | chromosome 16 |
| Location: | 4679269 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667350 | CAV6 | (1 of 2) PF00520//PF08016//PF16905 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel) // Voltage-dependent L-type calcium channel, IQ-associated (GPHH); Voltage-gated Ca2+ channel, alpha subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGAAGACGCACGAGCAGGACGCCTGGCGCCTGACGCCGCAGGTGCGC |
| Internal bar code: | GGGCTATCTAACCACCTTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 466 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGACCAGAGAGGCAGAG |
| Suggested primer 2: | CGACGTGTTGTGCGTTTCTT |