Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.020617 |
Chromosome: | chromosome 3 |
Location: | 3226541 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g165250 | (1 of 1) PF01248//PF12874 - Ribosomal protein L7Ae/L30e/S12e/Gadd45 family (Ribosomal_L7Ae) // Zinc-finger of C2H2 type (zf-met) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCGGCCCGCAGCCGCCGCGCCCACCGCCGCCGCCGACTGCGCCGCCC |
Internal bar code: | GAGAGGCTTTCAACATGTAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1849 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTCTCTGCCATCCCTTCT |
Suggested primer 2: | AAGGAAGTGGTCAGACTGCG |