| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.020641 |
| Chromosome: | chromosome 2 |
| Location: | 935613 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g079300 | VPS4 | AAA-ATPase of VPS4/SKD1 family; (1 of 1) K12196 - vacuolar protein-sorting-associated protein 4 (VPS4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCACCCCGACCGTCCACTTTGTCCTGGTGAGGTTGCTGCTACGGTAT |
| Internal bar code: | GTAAAACCACTAGGTGTCTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4748 |
| LEAP-Seq percent confirming: | 72.973 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTTACGCTCTGGACCTAG |
| Suggested primer 2: | GGCAAGATCACTGCCTCCTT |