| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.020734 |
| Chromosome: | chromosome 13 |
| Location: | 2774979 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g582350 | UBA5 | (1 of 1) K12164 - ubiquitin-like modifier-activating enzyme 5 (UBA5, UBE1DC1); UFM1 E1 activating enzyme | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTCCTCCCGCGTGGACCTGGTGCTGAGCTGCGTGGACAACTACGAG |
| Internal bar code: | CATGTTATCGAACCAACCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 393 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGGCGCGAAAGATACTTG |
| Suggested primer 2: | ACCCGAATTGCTGTCGATGT |