| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.020741 |
| Chromosome: | chromosome 10 |
| Location: | 5607867 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458450 | GPX5,GPXH | Glutathione peroxidase 5; (1 of 4) 1.11.1.9 - Glutathione peroxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGTACAAGGACCGGGGGCTCGTCATCCTTGGCTTCCGTGAGTAATATT |
| Internal bar code: | CTTCACAGCTCTTGACGTAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1470 |
| LEAP-Seq percent confirming: | 34.375 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGTAAACGGTGGATGTGA |
| Suggested primer 2: | GTCGCCAATAACCAATCGCC |