| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.020814 |
| Chromosome: | chromosome 7 |
| Location: | 1062434 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320000 | GT90-38,GT90F38 | GT90 family protein 38; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCTACTTCTTGATGCAGCTGGTGCTCATCTATAACAACACGCTGTAC |
| Internal bar code: | TGGTGCCTTTGTCATCATCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2264 |
| LEAP-Seq percent confirming: | 47.3684 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTAAGCAGACCCACACC |
| Suggested primer 2: | AGCCGTGGACTTGTTATGGG |