Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.020872 |
Chromosome: | chromosome 12 |
Location: | 7063715 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560250 | (1 of 5) PF04884 - Vitamin B6 photo-protection and homoeostasis (DUF647) | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGACCTGCTGATGGAGGCGGGTGCGGCGCTGGAGCTGGCCACCATCTA |
Internal bar code: | TTTGTTGGTAAATTCGAATAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 162 |
LEAP-Seq percent confirming: | 9.09091 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTGCTTCACTTGGGAACG |
Suggested primer 2: | ATCTACAACCCCATCCCCGA |