Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.020884 |
Chromosome: | chromosome 6 |
Location: | 3381026 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278090 | MRPL1 | (1 of 1) PTHR23105//PTHR23105:SF51 - RIBOSOMAL PROTEIN L7AE FAMILY MEMBER // SUBFAMILY NOT NAMED; Mitochondrial ribosomal protein L1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCCCGCCACGCCACCCACTTGTTCTCCAGCAGGCTCGCCACCAGGCC |
Internal bar code: | TTAATAGGTGTTGTAGTTGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 40.9091 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCATCAGTAAGCGCGCTG |
Suggested primer 2: | ATAGCCTGTGGGAAGATGCG |