| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.020909 |
| Chromosome: | chromosome 1 |
| Location: | 4593690 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031700 | FKM1 | DNA methylase in the FkbM family; (1 of 13) PF05050 - Methyltransferase FkbM domain (Methyltransf_21) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGCTGGTATTTACAACCCCTCCCCGGCTGCTCCCTGCTGCACTCACT |
| Internal bar code: | ACCTGTTGACTACGCAGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 18.1818 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGAACTTTCCTCGCCCC |
| Suggested primer 2: | GAGGCGTGTGAAGGGAAGAA |