Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.021032 |
Chromosome: | chromosome 10 |
Location: | 1233095 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g426400 | TRL8,TRX22 | (1 of 11) IPR012336//IPR013766 - Thioredoxin-like fold // Thioredoxin domain; Thioredoxin-like protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCAAACCCAGCCACCTACACACGCACACGCGCACACACGCCCATCC |
Internal bar code: | CTAGTATGTATCGGGTTGTTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2335 |
LEAP-Seq percent confirming: | 96.6667 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTAACATCGCGCTGACAGC |
Suggested primer 2: | CGTATGTTGCAGCGACACAG |