| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.021101 |
| Chromosome: | chromosome 11 |
| Location: | 42287 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467526 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCTCACAACCATCGAGTCGCGTCTGCGCTTCTACAAGCGGCTGGGAT |
| Internal bar code: | GGATATGACTGGCCAGACCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1524 |
| LEAP-Seq percent confirming: | 92.7711 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAAACAAATCGCAGCCC |
| Suggested primer 2: | CAGAGGATGCCAGCAAATGC |