| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.021191 |
| Chromosome: | chromosome 2 |
| Location: | 6678558 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387134 | (1 of 3) PF04379 - Protein of unknown function (DUF525) (DUF525) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGCGGTGCGGCACTCACTCGAAGCAGTCGTTCGGCGGGATGATGGGC |
| Internal bar code: | TCTGGGACCTATTCCGTCGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1968 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCTTCCAAGGTCTCATGT |
| Suggested primer 2: | AGCATACCACACTGCGTTGA |