| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.021248 |
| Chromosome: | chromosome 6 |
| Location: | 8392063 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307950 | MRPL9,bL9m | Mitochondrial ribosomal protein L9; (1 of 1) IPR000244//IPR009027//IPR020069//IPR020070 - Ribosomal protein L9 // Ribosomal protein L9/RNase H1, N-terminal // Ribosomal protein L9, C-terminal // Ribosomal protein L9, N-terminal | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAGCACCCGAACCCGCCAGCCCACCCCCGCCAGTTACCGCCCCAGTAC |
| Internal bar code: | AAGATGACATTATTGAACTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2492 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGGAGGTGGGGTAGAGC |
| Suggested primer 2: | TTCTCGCCCAAAACACCTGT |