Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.021348 |
Chromosome: | chromosome 4 |
Location: | 1157133 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g215700 | (1 of 4) IPR009030//IPR011641 - Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAAGCAAAGCGCGCACTGTCCTCGAATCCAGTGTGAAGCCCTGCGATG |
Internal bar code: | AATCAGTTAGTAGATTAATATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4870 |
LEAP-Seq percent confirming: | 97.351 |
LEAP-Seq n confirming: | 147 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 151 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAGAGCATTTGGTGGAGCC |
Suggested primer 2: | GCTGAACCATGCACGTTTGT |