| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.021429 |
| Chromosome: | chromosome 10 |
| Location: | 6743719 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g467000 | IFT55,IFT57 | (1 of 1) K04638 - estrogen-related receptor beta like 1 (ESRRBL1, HIPPI); Intraflagellar Transport Protein 57 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCTGAGGCATCTCCCCCTCCACCCGGCGACGATGGAGATGCTGGTGG |
| Internal bar code: | GAGACTCAGGATTTTGCAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 22073 |
| LEAP-Seq percent confirming: | 99.7525 |
| LEAP-Seq n confirming: | 403 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 404 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGTGCCCACATGTACAT |
| Suggested primer 2: | GGCCCCCTCACCTTTAAGTC |