| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.021553 |
| Chromosome: | chromosome 14 |
| Location: | 2490045 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g624201 | (1 of 1) PTHR10438//PTHR10438:SF247 - THIOREDOXIN // THIOREDOXIN-LIKE PROTEIN CDSP32, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCCCGCCAACCGTCACAGCACCGCAACACCCGCGCACCGACAACCCG |
| Internal bar code: | ACGCGACTTTTTCTAGTTGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2747 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTGAAGATGGACTGGCG |
| Suggested primer 2: | CCACTGTTGCAGTTCCTTGC |