| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.021556 |
| Chromosome: | chromosome 17 |
| Location: | 2673401 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717050 | (1 of 16) IPR003439//IPR003593//IPR013525//IPR027417 - ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTAAGTATGACTACCTGGGTCACGACAGTCACGCGACGCTCGGTAACA |
| Internal bar code: | TGAACTAAGTGAGTCACATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAATCCCCCTTCCTCCTCC |
| Suggested primer 2: | GATCCAGCCTATCCACACCG |