| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.021567 |
| Chromosome: | chromosome 17 |
| Location: | 1070472 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703700 | SCLB1,SCL2,SUCLA2 | Succinate-CoA ligase beta chain; (1 of 1) K01900 - succinyl-CoA synthetase beta subunit (LSC2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTAGGCGTGGTAATGGCAAGTTTCGGGGATGCATGCGACTTGAGCCAA |
| Internal bar code: | ACCGATGAACTACAGTTAGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1521 |
| LEAP-Seq percent confirming: | 25.2101 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | 119 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTCTGCAGCACCTGTAA |
| Suggested primer 2: | CCAAGTACTTGTCAGCGGGT |