| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.021614 |
| Chromosome: | chromosome 13 |
| Location: | 3418649 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586916 | SCL27,SRS6,SRS9 | Serine/arginine-rich pre-mRNA splicing factor; (1 of 2) K12900 - FUS-interacting serine-arginine-rich protein 1 (FUSIP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAAGCACAAGCACATGTCCCCAAGCACGCGCGGTCCGAGCATGTGGCA |
| Internal bar code: | TGTCAGGCCTGTACACTAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2895 |
| LEAP-Seq percent confirming: | 93.0233 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTTGTACATGGCGTCCT |
| Suggested primer 2: | CTGGGTTATGGCGCAAATCG |