Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.021641 |
Chromosome: | chromosome 17 |
Location: | 1442914 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g706450 | LIC3 | (1 of 1) IPR000104//IPR006029//IPR006201//IPR006202 - Antifreeze protein, type I // Neurotransmitter-gated ion-channel transmembrane domain // Neurotransmitter-gated ion-channel // Neurotransmitter-gated ion-channel ligand-binding domain; Ligand-gated ion channel | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGAAGGACGTGGCTTGCCGTCGGGCGGTGCGCATTGCATGCGCATTA |
Internal bar code: | GACTGGAATTTTGAGGTTCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 154 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGTGGCACCTCTTGTTTT |
Suggested primer 2: | TCGCCCTTACACAGACACAC |